Handmade quality · Free shipping over $75 · Explore the atelier

Immortalized RFP-Expressing Monkey Primary Cardiac Fibroblasts Size:0.5x10^6 Cells (Frozen Vial) This product was previously listed

SKU: 98165164034

4.6
USD1600.00 USD1629.00

Pay in 4 interest-free payments of $400.00 Learn more

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jul 26 - Jul 31

Description

This product was previously listed under catalog number 15-99217 and is now updated to BF-88458666 for improved product management

Applied in studies evaluating increased peripheral blood CD34+ yields in combination settings such as G-CSF

and negative regulation of cardiac muscle tissue regeneration

Forward Primer: AATGGATGATTTGATGCTGTCCC

the operation of a single sample can be completed within 30 minutes

Immortalized RFP-Expressing Monkey Primary Cardiac Fibroblasts Size:0.5x10^6 Cells (Frozen Vial) This product was previously listedDocuments MK 6049IM. RFP

Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy

You may also like

recommand products